ankrd12

Ensembl ID:
ENSDARG00000052419
ZFIN ID:
ZDB-GENE-040426-846
Description:
ankyrin repeat domain 12 [Source:RefSeq peptide;Acc:NP_956444]
Human Orthologue:
ANKRD12
Human Description:
ankyrin repeat domain 12 [Source:HGNC Symbol;Acc:29135]
Mouse Orthologue:
Ankrd12
Mouse Description:
ankyrin repeat domain 12 Gene [Source:MGI Symbol;Acc:MGI:1914357]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8899 Nonsense Mutation detected in F1 DNA During 2016
sa19905 Nonsense Available for shipment Available now
sa25937 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa11738 Nonsense Available for shipment Available now
sa33058 Nonsense Available for shipment Available now
sa6870 Nonsense Mutation detected in F1 DNA During 2016
sa19906 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270 Nonsense 46 424 3 10
ENSDART00000097864 Nonsense 46 1987 2 12
ENSDART00000146037   None 71 None 6
Genomic Location (Zv9):
Chromosome 2 (position 55360326)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55025325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAACTCCGAAGCTGGATYGGAGTGAACTCTTGGGGAAAGAGGGGAAGT[C/A]GAAATCCTCCATGAAGCGGAAACTCTCYTTCACTGKCAGTCCATCCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270   None 424 None 10
ENSDART00000097864 Nonsense 793 1987 8 12
ENSDART00000146037   None 71 None 6
Genomic Location (Zv9):
Chromosome 2 (position 55377801)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55042801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGAGCGGACTGATGGTACTTTCTCTGTACGAATTCCTGATGGCTCA[C/T]AACACTTGTCAGAAGAAGTGGATGAGAAACCAGCAACTTGTAATTCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270   None 424 None 10
ENSDART00000097864 Missense 799 1987 8 12
ENSDART00000146037 Essential Splice Site 21 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55377819)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55042819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACTTTCTCTGTACGAATTCCTGATGGCTCACAACACTTGTCAGAAGAA[G/A]TGGATGAGAAACCAGCAACTTGTAATTCGGCTGACCAAGAGCAACTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270   None 424 None 10
ENSDART00000097864 Nonsense 1106 1987 8 12
ENSDART00000146037   None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55378741)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55043741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTCAGTCTCAAAGATCAGGAAATCGAACAGTGGCACAAAAAGCACT[T/A]GGAGAAAATCAAGCAGAAGGAACGGGAGCGGCTAAAACAGCGTCCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270   None 424 None 10
ENSDART00000097864 Nonsense 1143 1987 8 12
ENSDART00000146037   None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55378851)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55043851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAACAACAAAAAAACAAGGAAAAAATTAAATCATCCTCTACGTCCACT[G/T]AGCCATGTCTAACCAAGGAACTAACTCGGTCAAAGAGCTCAGAAGCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270   None 424 None 10
ENSDART00000097864 Nonsense 1211 1987 8 12
ENSDART00000146037   None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55379056)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55044056
KASP Assay ID:
554-4684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCGATCTCCGAGACCAGARAGTGAAAAATCTGGTCTTATGTCAAGAT[C/A]AATATCAATGATCTCTGTGGCAAGTTCAGAAGACTCCTGCCAGGCAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074270   None 424 None 10
ENSDART00000097864 Nonsense 1330 1987 8 12
ENSDART00000146037   None 71 2 6
Genomic Location (Zv9):
Chromosome 2 (position 55379412)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55044412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGAAGAGTCTCCGGTAATCAGTATTGCATCACAACCAACCAGCGAG[C/T]AATCTCAAGTTCATCTAACTGAGATTAGTGTCCCCCCTGTTCAGGAGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link