crfb12

Ensembl ID:
ENSDARG00000052413
ZFIN IDs:
ZDB-GENE-060421-4184, ZDB-GENE-060421-4184
Description:
cytokine receptor family member B12 [Source:RefSeq peptide;Acc:NP_001035443]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40570 Nonsense Mutation detected in F1 DNA During 2016
sa8916 Nonsense Mutation detected in F1 DNA During 2016
sa20546 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074264 Nonsense 98 578 4 8
ENSDART00000129652 Nonsense 98 579 4 9
Genomic Location (Zv9):
Chromosome 5 (position 59030307)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57010979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTGAACTAAACTTTGACAAGCCACCTTTTGACCTCCATTGGAATTA[T/A]TTTTTGAGAGTCAAGGCAACATTTAAAGGGACAAGCTCAAACTGGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074264 Nonsense 458 578 8 8
ENSDART00000129652 Nonsense 458 579 8 9
Genomic Location (Zv9):
Chromosome 5 (position 59023288)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57003960
KASP Assay ID:
2259-6608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYTTTAAAGATGAATACATTCAGAGGGAAAATTTTACAATTGACCCATA[T/G]TTTATYGCCAGTCTTAACCCTTTAGATGAGGCTRAGATATCAAATCCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074264 Nonsense 568 578 8 8
ENSDART00000129652 Nonsense 568 579 8 9
Genomic Location (Zv9):
Chromosome 5 (position 59022958)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57003630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGAAATGAATGTATTGTTGCCTGAAAATGTCTTAGAAGGTGGCTA[T/G]GAACCAAGACATAATAACAAATATGAAGTATAAGGTAAGGATTTAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link