crfb12

Ensembl ID:
ENSDARG00000052413
ZFIN IDs:
ZDB-GENE-060421-4184, ZDB-GENE-060421-4184
Description:
cytokine receptor family member B12 [Source:RefSeq peptide;Acc:NP_001035443]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8916 Nonsense Mutation detected in F1 DNA During 2014
sa20546 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074264 Nonsense 458 578 8 8
ENSDART00000129652 Nonsense 458 579 8 9
Genomic Location:
Chromosome 5 (position 59023288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYTTTAAAGATGAATACATTCAGAGGGAAAATTTTACAATTGACCCATA[T/G]TTTATYGCCAGTCTTAACCCTTTAGATGAGGCTRAGATATCAAATCCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074264 Nonsense 568 578 8 8
ENSDART00000129652 Nonsense 568 579 8 9
Genomic Location:
Chromosome 5 (position 59022958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGAAATGAATGTATTGTTGCCTGAAAATGTCTTAGAAGGTGGCTA[T/G]GAACCAAGACATAATAACAAATATGAAGTATAAGGTAAGGATTTAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1te3recb