dnmt7

Ensembl ID:
ENSDARG00000052402
ZFIN ID:
ZDB-GENE-050314-4
Description:
DNA methyltransferase [Source:RefSeq peptide;Acc:NP_001018312]
Human Orthologue:
DNMT3B
Human Description:
DNA (cytosine-5-)-methyltransferase 3 beta [Source:HGNC Symbol;Acc:2979]
Mouse Orthologue:
Dnmt3b
Mouse Description:
DNA methyltransferase 3B Gene [Source:MGI Symbol;Acc:MGI:1261819]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14480 Nonsense Available for shipment Available now
sa31654 Essential Splice Site Available for shipment Available now
sa41193 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046460 Nonsense 298 1433 5 25
ENSDART00000085361 Nonsense 298 1456 5 26
ENSDART00000125729 Nonsense 298 1500 4 25
ENSDART00000145062 Nonsense 298 1433 5 24
Genomic Location (Zv9):
Chromosome 8 (position 24214485)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23340303
KASP Assay ID:
2260-0538.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WATCCAAACGACATTGTTTCTGCTTGTAAGCTGAAYCCGTACTGTATCTA[C/A]ATATATGGGCAGGTACCACTTGATGTGAAGACTGGAGACAAGACCMACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046460 Essential Splice Site 808 1433 7 25
ENSDART00000085361 Essential Splice Site 831 1456 8 26
ENSDART00000125729 Essential Splice Site 831 1500 7 25
ENSDART00000145062 Essential Splice Site 808 1433 7 24
Genomic Location (Zv9):
Chromosome 8 (position 24217326)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23343144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGGAGCCAAAAATGATGGCACCTTGACTAGTAACACATTAAAGGAGG[T/G]AATATTATTATTTTTTACAAAAAAAGTATTCAGACTTGTTTTTAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046460 Nonsense 991 1433 12 25
ENSDART00000085361 Nonsense 1014 1456 13 26
ENSDART00000125729 Nonsense 1058 1500 13 25
ENSDART00000145062 Nonsense 991 1433 12 24
Genomic Location (Zv9):
Chromosome 8 (position 24224670)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23350488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTATCAGCCTCCAGCAAAGAGAAAGTATGTCTTCAAGAACAGACCAT[C/A]AACTCAGGAGTGCAACAGAGGTCAGTTATATCAGGGGTTCCCAAACATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link