pkz

Ensembl ID:
ENSDARG00000052396
ZFIN IDs:
ZDB-GENE-050301-2, ZDB-GENE-050301-2, ZDB-GENE-050301-2
Description:
protein kinase containing Z-DNA binding domains [Source:RefSeq peptide;Acc:NP_001035466]
Human Orthologue:
EIF2AK2
Human Description:
eukaryotic translation initiation factor 2-alpha kinase 2 [Source:HGNC Symbol;Acc:9437]
Mouse Orthologue:
Eif2ak2
Mouse Description:
eukaryotic translation initiation factor 2-alpha kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1353449]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22387 Essential Splice Site Available for shipment Available now
sa42307 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42306 Nonsense Mutation detected in F1 DNA During 2017
sa22386 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038391 Essential Splice Site 205 511 3 11
ENSDART00000074230 Essential Splice Site 205 448 3 9
ENSDART00000123580 Essential Splice Site 205 489 3 12
Genomic Location (Zv9):
Chromosome 13 (position 51174624)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49885721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGATTGATGACAAGATCTATGCTGTGAAGAGAGTCGAGTTCAACAGG[T/G]AAGTTCACATCATGAGATCATGACTCAACTTAGAATGAACACTCGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038391 Essential Splice Site 246 511 4 11
ENSDART00000074230 Essential Splice Site 246 448 4 9
ENSDART00000123580 Essential Splice Site 246 489 4 12
Genomic Location (Zv9):
Chromosome 13 (position 51171859)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49882956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATTCTGACAACTGGATGTCAAATCAAGAAACAAACGAAAAGTCAAA[G/T]TAAGCAAATCTTCAACACTGTAGACCGAAACACTCAGTTCTTCACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038391 Nonsense 410 511 8 11
ENSDART00000074230 Nonsense 347 448 6 9
ENSDART00000123580 Nonsense 388 489 9 12
Genomic Location (Zv9):
Chromosome 13 (position 51168717)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49879814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGTGGTGACCCTATAGAGCGGTCAAAGAGGAAGGGCACACCCACATA[T/A]ATGAGTCCTGAACAGGTGACATATTTAAACTTTTAGCTTTTTCACAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038391 Essential Splice Site 449 511 9 11
ENSDART00000074230 Essential Splice Site 386 448 7 9
ENSDART00000123580 Essential Splice Site 427 489 10 12
Genomic Location (Zv9):
Chromosome 13 (position 51167785)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49878882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTTGAAATGCTGTGGAAAATATCTTCTGGGATGGAGAGAGCAGAGG[T/G]CAGTATTGTTTCATTTATAATGTCATTCATTCATTCATTCATTCATTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link