pcgf5b

Ensembl ID:
ENSDARG00000052388
ZFIN ID:
ZDB-GENE-060512-34
Description:
Polycomb group RING finger protein 5-B [Source:UniProtKB/Swiss-Prot;Acc:Q1JPS1]
Human Orthologue:
PCGF5
Human Description:
polycomb group ring finger 5 [Source:HGNC Symbol;Acc:28264]
Mouse Orthologue:
Pcgf5
Mouse Description:
polycomb group ring finger 5 Gene [Source:MGI Symbol;Acc:MGI:1923505]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5852 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086211 Essential Splice Site 70 232 3 9
Genomic Location (Zv9):
Chromosome 12 (position 17496312)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16376022
KASP Assay ID:
554-3927.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAATGTGGTATCCAGGTTCATGAAACAAATCCCTTGGAGATGTTAAG[G/A]TAAACCACACTCATATAACATCTTACTACTGAGCTAAACCTTCAACCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link