psmd12

Ensembl ID:
ENSDARG00000052377
ZFIN ID:
ZDB-GENE-030131-617
Description:
26S proteasome non-ATPase regulatory subunit 12 [Source:RefSeq peptide;Acc:NP_963872]
Human Orthologue:
PSMD12
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 [Source:HGNC Symbol;Acc:9557]
Mouse Orthologue:
Psmd12
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Gene [Source:MGI Symbol;Acc:MGI:1914247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057321 Nonsense 226 456 7 11
ENSDART00000126186 Nonsense 206 436 6 10
Genomic Location (Zv9):
Chromosome 6 (position 23214180)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19469626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTAATGTTTTGCTTTCTTTTAATGTATAGGAATTGAAATTGAAGTA[T/A]TATAATCTGATGATTCAAGTTGATCTGCATGAGGGCTCCTACCTGTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link