faf2

Ensembl ID:
ENSDARG00000052374
ZFIN ID:
ZDB-GENE-050208-312
Description:
Zgc:194819 protein [Source:UniProtKB/TrEMBL;Acc:B3DID0]
Human Orthologue:
FAF2
Human Description:
Fas associated factor family member 2 [Source:HGNC Symbol;Acc:24666]
Mouse Orthologue:
Faf2
Mouse Description:
Fas associated factor family member 2 Gene [Source:MGI Symbol;Acc:MGI:1923827]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42443 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029797 Nonsense 211 445 7 11
Genomic Location (Zv9):
Chromosome 14 (position 47707113)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 45854357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAAGAGGCGCTCACCTTCATCAACACGAGGATGTTGTTCTGGGCATG[T/A]TCCACCAGCAAACCAGAGGGTTACAGAGGTGAACCAGCTGCACTTCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link