ociad2

Ensembl ID:
ENSDARG00000052336
ZFIN ID:
ZDB-GENE-041014-253
Description:
OCIA domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001038321]
Human Orthologue:
OCIAD2
Human Description:
OCIA domain containing 2 [Source:HGNC Symbol;Acc:28685]
Mouse Orthologue:
Ociad2
Mouse Description:
OCIA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1916377]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18654 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074167 Nonsense 56 165 2 7
Genomic Location:
Chromosome 20 (position 23227000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGTGAAGCAGATATGGATGGAATGCCAGCATGATAGCTTCTGGTAT[C/T]GAGGTAAAGAGACACTTGAAATTATTTACYATCACATATAGTGAGTGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cty0t2i8