si:dkey-117k10.8

Ensembl ID:
ENSDARG00000052332
ZFIN ID:
ZDB-GENE-081105-171
Description:
Novel protein with a Zinc finger, C3HC4 type (RING finger) domain [Source:UniProtKB/TrEMBL;Acc:A9C3N

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41268 Nonsense Mutation detected in F1 DNA During 2017
sa27249 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074163 Nonsense 197 627 7 12
ENSDART00000139266 Nonsense 25 350 2 7
Genomic Location (Zv9):
Chromosome 8 (position 41790612)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39804192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGATCCACTTACCAACTTCAGGGGTGGAGAAAATTATCCTTTGGATTA[T/A]AGGTAAGTTTCAGAATCATTTATTTTCTGTACTTTTAAGGCACGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074163 Essential Splice Site 258 627 9 12
ENSDART00000139266 Essential Splice Site 86 350 4 7
Genomic Location (Zv9):
Chromosome 8 (position 41787716)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39801296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACAGTCTCAACAAACAACAGCCAAATGGACAACACCTTCATGCTAAAG[T/A]AAGGGAATGTGTTACATGTGACCCTGAGACACAAAACCCAAAACTTTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link