tlr5b

Ensembl ID:
ENSDARG00000052322
ZFIN ID:
ZDB-GENE-040219-15
Description:
toll-like receptor 5b [Source:RefSeq peptide;Acc:NP_001124067]
Human Orthologue:
TLR5
Human Description:
toll-like receptor 5 [Source:HGNC Symbol;Acc:11851]
Mouse Orthologue:
Tlr5
Mouse Description:
toll-like receptor 5 Gene [Source:MGI Symbol;Acc:MGI:1858171]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6655 Nonsense Mutation detected in F1 DNA During 2014
sa16424 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074153 Nonsense 37 875 2 2
Genomic Location:
Chromosome 20 (position 51811084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCACCTCCGWGTGTTCAGTTATCGGCTATAATGCCATCTGCATAAAC[A/T]GAGGTCTTCATCAGGTGCCAGAGCTGCCCGCGCATGTCAATTATGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074153 Nonsense 857 875 2 2
Genomic Location:
Chromosome 20 (position 51813544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTTATGACCAACTTCTGCACAAGATAAGAAAARATATCAAGATTAAT[C/T]AAACGACCAAAGAAAYAAAGCRTGAGGAAGCCAATTTCAACACCAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mlzpl5jp