si:ch211-175l6.6

Ensembl ID:
ENSDARG00000052314
ZFIN ID:
ZDB-GENE-060503-484
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MT08]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39995 Nonsense Mutation detected in F1 DNA During 2017
sa33093 Nonsense Available for shipment Available now
sa15080 Nonsense Available for shipment Available now
sa17828 Essential Splice Site Available for shipment Available now
sa25241 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25994 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Nonsense 34 292 1 5
ENSDART00000133133 Nonsense 32 448 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8151021)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8054581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAAATCTTCAAGAATCCTGTAGTTTTATCATGCAGTCACAGTGTGTG[T/A]AAAGAGTGTCTTCAACAGTACTGGAGAACCAAGACAACTCAGGAGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Nonsense 74 292 1 5
ENSDART00000133133 Nonsense 72 448 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8151140)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8054462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAAGGTGAACCTCCAGTTAATCTTGCATTAAAAAACCTGTGTGAGT[T/A]GTTCCTGAAGGAGAGAAATGAGAGATGTTCATCAGCATCTGAGGAGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Nonsense 93 292 1 5
ENSDART00000133133 Nonsense 91 448 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8151197)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8054405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGAGAGAAATGAGAGATGTTCATCAGCATCTGAGGAGATCTGCAGTT[T/A]ACACAGTGAGAARCTCAAACTCTTCTGTCTGGAGGACAAACAGCCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Essential Splice Site 167 292 2 5
ENSDART00000133133 Essential Splice Site 165 448 2 6
Genomic Location (Zv9):
Chromosome 3 (position 8152476)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8053126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGAAGAAAKGAAAGCAGAGTTTGAGAAAACAKTTCAACACATCAAGG[T/C]GAGGAAAMATTTCAATTCAAACATTTTCATTGCAGCCGCAGGAGACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Essential Splice Site 245 292 4 5
ENSDART00000133133 Essential Splice Site 243 448 4 6
Genomic Location (Zv9):
Chromosome 3 (position 8153001)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8052601
KASP Assay ID:
554-7321.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGATGATGGATTGAGCTCTTGATGATCAGTTGTGTGTTTGTTCTGC[A/T]GGAGTTTCCAGTCTCGATGGAAAGGTGAGTGATCTGCTGGTGTCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695 Essential Splice Site 252 292 4 5
ENSDART00000133133 Essential Splice Site 250 448 4 6
Genomic Location (Zv9):
Chromosome 3 (position 8153026)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8052576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCAGTTGTGTGTTTGTTCTGCAGGAGTTTCCAGTCTCGATGGAAAG[G/T]TGAGTGATCTGCTGGTGTCTCTGCTCTCTCTGCTTCTGAATCCTGCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028695   None 292 None 5
ENSDART00000133133 Nonsense 352 448 6 6
Genomic Location (Zv9):
Chromosome 3 (position 8170942)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8034660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGWTCAGAGGGTTTCATCTCAGGGAAACACTGCTGGGATGTGGAGGTC[A/T]AAGAAAGTTTATACTGGAAYTTTGGAGTAWCTACAGCATCAAACCAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link