
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
uqcrc1
- Ensembl ID:
- ENSDARG00000052304
- ZFIN ID:
- ZDB-GENE-040426-1792
- Description:
- cytochrome b-c1 complex subunit 1, mitochondrial [Source:RefSeq peptide;Acc:NP_957114]
- Human Orthologue:
- UQCRC1
- Human Description:
- ubiquinol-cytochrome c reductase core protein I [Source:HGNC Symbol;Acc:12585]
- Mouse Orthologue:
- Uqcrc1
- Mouse Description:
- ubiquinol-cytochrome c reductase core protein 1 Gene [Source:MGI Symbol;Acc:MGI:107876]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1488 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1488
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128047 | Essential Splice Site | 46 | 503 | 1 | 13 |
The following transcripts of ENSDARG00000052304 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 24021552)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 20276998 GRCz11 6 22337220 - KASP Assay ID:
- 554-1413.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTTCCCTCTATGTGGCGGATCAGTCGAGCTCTTACTAAAGCTGGCTACG[T/G]AAGTATTGCGAGCCCTTGGAATACTAAAGTGTTTTTAAAGAGTTTCAAAC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: