uqcrc1

Ensembl ID:
ENSDARG00000052304
ZFIN ID:
ZDB-GENE-040426-1792
Description:
cytochrome b-c1 complex subunit 1, mitochondrial [Source:RefSeq peptide;Acc:NP_957114]
Human Orthologue:
UQCRC1
Human Description:
ubiquinol-cytochrome c reductase core protein I [Source:HGNC Symbol;Acc:12585]
Mouse Orthologue:
Uqcrc1
Mouse Description:
ubiquinol-cytochrome c reductase core protein 1 Gene [Source:MGI Symbol;Acc:MGI:107876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1488 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128047 Essential Splice Site 46 503 1 13

The following transcripts of ENSDARG00000052304 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 24021552)
KASP Assay ID:
554-1413.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCCCTCTATGTGGCGGATCAGTCGAGCTCTTACTAAAGCTGGCTACG[T/G]AAGTATTGCGAGCCCTTGGAATACTAAAGTGTTTTTAAAGAGTTTCAAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8jomi55n