uqcrc1

Ensembl ID:: ENSDARG00000052304
ZFIN ID:: ZDB-GENE-040426-1792
Description:: cytochrome b-c1 complex subunit 1, mitochondrial [Source:RefSeq peptide;Acc:NP_957114]
Human Orthologue:: UQCRC1
Human Description:: ubiquinol-cytochrome c reductase core protein I [Source:HGNC Symbol;Acc:12585]
Mouse Orthologue:: Uqcrc1
Mouse Description:: ubiquinol-cytochrome c reductase core protein 1 Gene [Source:MGI Symbol;Acc:MGI:107876]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa1488	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa1488
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000128047	Essential Splice Site	46	503	1	13

The following transcripts of ENSDARG00000052304 do not overlap with this mutation:

Genomic Location:

Chromosome 6 (position 24021552)

KASP Assay ID:

554-1413.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GGTTCCCTCTATGTGGCGGATCAGTCGAGCTCTTACTAAAGCTGGCTACG[T/G]AAGTATTGCGAGCCCTTGGAATACTAAAGTGTTTTTAAAGAGTTTCAAAC

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

OMIM

OMIM information for UQCRC1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: