ENSDARG00000052288

Ensembl ID:
ENSDARG00000052288
Human Orthologue:
HARBI1
Human Description:
harbinger transposase derived 1 [Source:HGNC Symbol;Acc:26522]
Mouse Orthologue:
Harbi1
Mouse Description:
harbinger transposase derived 1 Gene [Source:MGI Symbol;Acc:MGI:2443194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10237 Nonsense Available for shipment Available now
sa40692 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102701 Nonsense 56 408 1 4
Genomic Location (Zv9):
Chromosome 6 (position 24364389)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20619835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAAAGACCGTAATGTTTACATATTTGGCWACAAAGAGTTCTGTGCGA[C/T]GAACATGGGCATTTCCGCGGATCCACGGGAAAGTATTTTGGGGGAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102701 Nonsense 235 408 3 4
Genomic Location (Zv9):
Chromosome 6 (position 24365934)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 20621380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTAATATTGAGATAATTATTATTTTTTCAGTTTTACGGATGTGTA[T/A]GTGGGTTGGCCAGGTCGAACTCACGATGCAAGAGTGCTAGCCAACTCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link