si:ch211-175l6.8

Ensembl ID:
ENSDARG00000052285
ZFIN ID:
ZDB-GENE-060503-673
Description:
hypothetical protein LOC561579 [Source:RefSeq peptide;Acc:NP_001038429]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9846 Nonsense Available for shipment Available now
sa18747 Nonsense Mutation detected in F1 DNA During 2017
sa39996 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074102 Nonsense 116 451 1 6
ENSDART00000074102 Nonsense 116 451 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8179305)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8026297
KASP Assay ID:
2259-3056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTRTCTGGAGGACAAACAGCCTGTGTGTTTAGTGTGCAGAGACTCCWAA[C/T]AACACGACAATCACAAATTCAGACCCATCAGTGAAGTGGTTTCTTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074102 Nonsense 116 451 1 6
ENSDART00000074102 Nonsense 116 451 1 6
Genomic Location (Zv9):
Chromosome 3 (position 8179305)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8026297
KASP Assay ID:
2259-3056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTGGAGGACAAACAGCCTGTGTGTTTAGTGTGCAGAGACTCCAAA[C/T]AACACGACAATCACAAATTCAGACCCATCAGTGAAGTGGTTTCTTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074102 Nonsense 365 451 6 6
Genomic Location (Zv9):
Chromosome 3 (position 8186706)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8018896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGGTCAAAGAGAGTCGATGCTGGAGTCTTGGAGTAACTACAGCGT[C/A]AAACCAGAGGAGGGGATGGGTTTTCTTTAGGACCGGTGTCTGGGGTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link