LOC100332594

Ensembl ID:
ENSDARG00000052254
Human Orthologue:
ZNF644
Human Description:
zinc finger protein 644 [Source:HGNC Symbol;Acc:29222]
Mouse Orthologue:
Zfp644
Mouse Description:
zinc finger protein 644 Gene [Source:MGI Symbol;Acc:MGI:1277212]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14999 Nonsense Available for shipment Available now
sa7038 Nonsense Mutation detected in F1 DNA During 2014
sa15981 Nonsense Available for shipment Available now
sa5360 Nonsense Mutation detected in F1 DNA During 2014
sa8229 Nonsense Mutation detected in F1 DNA During 2014
sa6068 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 242 1267 2 6
Genomic Location:
Chromosome 6 (position 20893643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGATGGWCTGAACTGGGGCCTGCAGGAGAAGTTCATGCGGATACTGT[T/A]GAACAGCAGCGTAGCAGGTGATGGGGTAAGAACAAAGGTGGAGATTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 348 1267 2 6
Genomic Location:
Chromosome 6 (position 20893960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCGACAAGTCAGCTGCCATGAAGGAGCTAATTTCAAGCGAGAAGGAA[G/T]AGAGATGTGATGAAGGCGGCAGCGACRTAGAAACAAACACCTACATGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 585 1267 2 6
Genomic Location:
Chromosome 6 (position 20894671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATGATCAACCCAAAACCAAGGACTTATCCTTGCCTATGCCAAAGATK[C/T]AAAGCACAGAGAAATGGTCAGTTAAGGACAGAGGTGAGCTGCCCTTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 819 1267 2 6
Genomic Location:
Chromosome 6 (position 20895373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCCCTTTCAACAACAACATTCCTGACTATGCCAGTCATTCTAATCCA[G/T]AAGATAGCATAGAAGAGGACAGCGATGAGATTCGTACATTTATAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Nonsense 976 1267 3 6
Genomic Location:
Chromosome 6 (position 20895997)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTCCAATCATGTGCGGGGCCACCTGAAGCGGATTGGCAAGCCTATTT[C/A]GGGTGCTAGCAAGTCACCTCTCWGCATTCWGTCTGAACTTCTTCAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074082 Essential Splice Site 1119 1267 3 6
Genomic Location:
Chromosome 6 (position 20896429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MGGCATACCCAGAACACCATCTGTGAAGCTTGATCCTACCTGGAGCCAAG[G/A]TTAGGAACCATACATTCACTCATTGATTTGTCATTAGCCAGAAAATGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v7cipti8