AFF2

Ensembl ID:
ENSDARG00000052242
Description:
AF4/FMR2 family, member 2 [Source:HGNC Symbol;Acc:3776]
Human Orthologue:
AFF2
Human Description:
AF4/FMR2 family, member 2 [Source:HGNC Symbol;Acc:3776]
Mouse Orthologue:
Aff2
Mouse Description:
AF4/FMR2 family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1202294]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42382 Nonsense Mutation detected in F1 DNA During 2016
sa17308 Essential Splice Site Available for shipment Available now
sa2742 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa42382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 526 1269 11 21
Genomic Location (Zv9):
Chromosome 14 (position 21695779)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20397267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGTGGATTAAAAAAGTGAATCCTCACAATAAAGCACTAATTAACACC[C/T]AGGCAGATAGTCATGGGCTTAACAGTTCTCAACCTGATGAAAGCCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Essential Splice Site 846 1269 11 21
Genomic Location (Zv9):
Chromosome 14 (position 21696743)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20398231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTATCCCTRCAGAAAAGAACCCAAGCAAATCRAAGAGGAAACACAAGG[C/A]AAGTCTKAAATGTTGTTGCTCTCGCCTCRTACACTCTATAATTATCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2742
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 1032 1269 15 21
Genomic Location (Zv9):
Chromosome 14 (position 21707665)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20409153
KASP Assay ID:
554-2703.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTACAGTGTTCACAGTGCAGATTACTACATGCAAGAAGCCAAGAAGT[T/A]GAAGCACAAGGCTGATGCTTTGGTAAGTCTGGCTAATATGTTGATGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link