AFF2

Ensembl ID:
ENSDARG00000052242
Description:
AF4/FMR2 family, member 2 [Source:HGNC Symbol;Acc:3776]
Human Orthologue:
AFF2
Human Description:
AF4/FMR2 family, member 2 [Source:HGNC Symbol;Acc:3776]
Mouse Orthologue:
Aff2
Mouse Description:
AF4/FMR2 family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1202294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17308 Essential Splice Site Available for shipment Available now
sa2742 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Essential Splice Site 846 1269 11 21
Genomic Location:
Chromosome 14 (position 21696743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTATCCCTRCAGAAAAGAACCCAAGCAAATCRAAGAGGAAACACAAGG[C/A]AAGTCTKAAATGTTGTTGCTCTCGCCTCRTACACTCTATAATTATCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2742
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074070 Nonsense 1032 1269 15 21
Genomic Location:
Chromosome 14 (position 21707665)
KASP Assay ID:
554-2703.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTACAGTGTTCACAGTGCAGATTACTACATGCAAGAAGCCAAGAAGT[T/A]GAAGCACAAGGCTGATGCTTTGGTAAGTCTGGCTAATATGTTGATGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cmbizuc2