pcdh15a

Ensembl ID:
ENSDARG00000052232
ZFIN ID:
ZDB-GENE-030616-3
Description:
protocadherin 15a [Source:RefSeq peptide;Acc:NP_001012500]
Human Orthologue:
PCDH15
Human Description:
protocadherin-related 15 [Source:HGNC Symbol;Acc:14674]
Mouse Orthologue:
Pcdh15
Mouse Description:
protocadherin 15 Gene [Source:MGI Symbol;Acc:MGI:1891428]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19068 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42279 Nonsense Mutation detected in F1 DNA During 2017
sa483 Essential Splice Site Confirmed mutation in F2 line During 2017
sa2682 Essential Splice Site F2 line generated During 2017
sa13589 Nonsense Available for shipment Available now
sa22367 Nonsense Available for shipment Available now
sa5868 Nonsense Mutation detected in F1 DNA During 2017
sa1509 Nonsense Available for shipment Available now
sa35571 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Essential Splice Site 36 1796 3 35
ENSDART00000139931   None 1308 None 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 42093645)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41315261
KASP Assay ID:
2260-6868.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCTCTGCTGCTGACACTAACGTCCCTCAGACTGGCACTATGAGGG[T/C]AAGACTGCTTTTCTTTCCTCTTTCACATCTTTTTTCCACTCTCCACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Nonsense 190 1796 7 35
ENSDART00000139931   None 1308 None 21
ENSDART00000143450 Nonsense 190 297 7 9
Genomic Location (Zv9):
Chromosome 13 (position 41979209)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41241261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCTTCTCAGGAAACAATGGAGCCACGGACATTGACGACGGACCAAAC[G/T]GACAGATTGAATACGCCATTCAGTATAACCCAAATGACCCGGTACTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa483
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Essential Splice Site 333 1796 10 35
ENSDART00000139931   None 1308 None 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41963872)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41225924
KASP Assay ID:
554-0334.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAGCCGCCCTCAGATAGACCTGGAATCTTGTACTTCATACTGGTTG[G/A]TGGGTATTTAAATGAGGATTCAATTAAAGGGATAGTTCACCCAAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2682
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Essential Splice Site 644 1796 16 35
ENSDART00000139931 Essential Splice Site 159 1308 3 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41931848)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41193900
KASP Assay ID:
554-2576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGATCAGCGAGGCCATGAGGATAGGAGCCATACTGCTCAACCTGCAG[G/A]TWCACACTGACTTTGGAATATTGCCTAATTTARTTTTCYCCCAAYGTTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Nonsense 1008 1796 23 35
ENSDART00000139931 Nonsense 523 1308 10 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41867326)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41129378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGTTATCACCAAAGTCAACCTGAATGAGCAACCCACCACTGTTTTC[A/T]AGGTGAGTCTGAGCTCAGTACACGTCTTTCTGCTCAKATGTGCCTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Nonsense 1226 1796 28 35
ENSDART00000139931 Nonsense 741 1308 15 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41826863)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41088915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGAGCGCCATCATGTTTAGAAACATGCGCCGGTCCTACTTCAAGTTT[C/T]AGGTCGTCGCCACAGATGACTATGGAAAGGGGCTCACCAGCAAAGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Nonsense 1516 1796 35 35
ENSDART00000139931 Nonsense 1028 1308 21 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41784237)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41046289
KASP Assay ID:
554-3953.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGCAGCAAGCTTCCCAAATCAGAAAGCGCCATCACCTTCCTGTCAGAC[G/T]AACGGCCACTCACTACTCAAAATCCCATTTTCCAGGATGGCCTATCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Nonsense 1560 1796 35 35
ENSDART00000139931 Nonsense 1072 1308 21 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41784105)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41046157
KASP Assay ID:
554-1433.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTGGTTTTCTGTACAGTGACCCACCTTCTCCAACAAGCCCCTGYGGT[C/T]AATTCACCTCATGGTCACTGCCATCCAGAATTCGAGGAMGAGGATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067058 Nonsense 1634 1796 35 35
ENSDART00000139931 Nonsense 1146 1308 21 21
ENSDART00000143450   None 297 None 9
Genomic Location (Zv9):
Chromosome 13 (position 41783883)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41045935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAACTATCAGTCAGAGAACAGGCCAGACAGTTTGAGGCTTTGGCTGAT[C/T]GAACCCCCAGGCAAAGTCGTGACTCTTACGCATCTTTGGATCCTGACGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link