c3c

Ensembl ID:: ENSDARG00000052207
ZFIN ID:: ZDB-GENE-990415-37
Description:: complement component c3c [Source:RefSeq peptide;Acc:NP_001032313]
Human Orthologue:: C3
Human Description:: complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:: C3
Mouse Description:: complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa12504	Essential Splice Site	Available for shipment	Available now
sa9572	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa12504
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000052683	Essential Splice Site	198	1651	5	41

Genomic Location:: Chromosome 1 (position 56826350)
KASP Assay ID:: 2259-1285.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GCAGAAAAAGGTGTGAARTCTTCRATCTACAACATCCCTGAGGTTACTAG[G/A]TGTGTAAATCACTGTTGGGACTAATACGATTCAMCTAGRGTTAACTGGCC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa9572
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000052683	Nonsense	1034	1651	24	41

Genomic Location:: Chromosome 1 (position 56850149)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: ATTATCTGGACAACACCAATCAGTGGGAATCTGTTGGCATTGACCGCCGT[A/T]AAGTTGCCATTAACCATATCAAAACAGGTCAGGATACAACAGATNNNNNN
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Age-related macular degeneration: Common variants near FRK/COL10A1 and VEGFA are associated with advanced age-related macular degeneration. (View Study)
Age-related macular degeneration: Genetic variants near TIMP3 and high-density lipoprotein-associated loci influence susceptibility to age-related macular degeneration. (View Study)
Age-related macular degeneration: Genome-wide association identifies SKIV2L and MYRIP as protective factors for age-related macular degeneration. (View Study)
Age-related macular degeneration: Genome-wide association study of advanced age-related macular degeneration identifies a role of the hepatic lipase gene (LIPC). (View Study)
Age-related macular degeneration (GA): Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes. (View Study)
Complement C3 and C4 levels: Genome-wide association study for serum complement C3 and C4 levels in healthy Chinese subjects. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

More OMIM information for C3

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: