c3c

Ensembl ID:
ENSDARG00000052207
ZFIN ID:
ZDB-GENE-990415-37
Description:
complement component c3c [Source:RefSeq peptide;Acc:NP_001032313]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12504 Essential Splice Site Available for shipment Available now
sa32793 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9572 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Essential Splice Site 198 1651 5 41
Genomic Location (Zv9):
Chromosome 1 (position 56826350)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55610283
KASP Assay ID:
2259-1285.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAAAGGTGTGAARTCTTCRATCTACAACATCCCTGAGGTTACTAG[G/A]TGTGTAAATCACTGTTGGGACTAATACGATTCAMCTAGRGTTAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Essential Splice Site 857 1651 20 41
Genomic Location (Zv9):
Chromosome 1 (position 56841268)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55625201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAATCAAGGCCATTATTCACAACTACACCCCCAAACACCTGAAGAAG[G/A]TAGGTTTGACAGTTGGGTAGGCTGGCTTTCAGAATGTATTAATTATTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Nonsense 1034 1651 24 41
Genomic Location (Zv9):
Chromosome 1 (position 56850149)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55634082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCTGGACAACACCAATCAGTGGGAATCTGTTGGCATTGACCGCCGT[A/T]AAGTTGCCATTAACCATATCAAAACAGGTCAGGATACAACAGATNNNNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link