Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
c3c
- Ensembl ID:
- ENSDARG00000052207
- ZFIN ID:
- ZDB-GENE-990415-37
- Description:
- complement component c3c [Source:RefSeq peptide;Acc:NP_001032313]
- Human Orthologue:
- C3
- Human Description:
- complement component 3 [Source:HGNC Symbol;Acc:1318]
- Mouse Orthologue:
- C3
- Mouse Description:
- complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa12504 | Essential Splice Site | Available for shipment | Available now |
| sa32793 | Essential Splice Site | Mutation detected in F1 DNA | During 2016 |
| sa9572 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12504
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000052683 | Essential Splice Site | 198 | 1651 | 5 | 41 |
- Genomic Location (Zv9):
- Chromosome 1 (position 56826350)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 55610283 - KASP Assay ID:
- 2259-1285.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGAAAAAGGTGTGAARTCTTCRATCTACAACATCCCTGAGGTTACTAG[G/A]TGTGTAAATCACTGTTGGGACTAATACGATTCAMCTAGRGTTAACTGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32793
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2016.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000052683 | Essential Splice Site | 857 | 1651 | 20 | 41 |
- Genomic Location (Zv9):
- Chromosome 1 (position 56841268)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 55625201 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAAATCAAGGCCATTATTCACAACTACACCCCCAAACACCTGAAGAAG[G/A]TAGGTTTGACAGTTGGGTAGGCTGGCTTTCAGAATGTATTAATTATTACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9572
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000052683 | Nonsense | 1034 | 1651 | 24 | 41 |
- Genomic Location (Zv9):
- Chromosome 1 (position 56850149)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 55634082 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTATCTGGACAACACCAATCAGTGGGAATCTGTTGGCATTGACCGCCGT[A/T]AAGTTGCCATTAACCATATCAAAACAGGTCAGGATACAACAGATNNNNNN
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: Common variants near FRK/COL10A1 and VEGFA are associated with advanced age-related macular degeneration. (View Study)
- Age-related macular degeneration: Genetic variants near TIMP3 and high-density lipoprotein-associated loci influence susceptibility to age-related macular degeneration. (View Study)
- Age-related macular degeneration: Genome-wide association identifies SKIV2L and MYRIP as protective factors for age-related macular degeneration. (View Study)
- Age-related macular degeneration: Genome-wide association study of advanced age-related macular degeneration identifies a role of the hepatic lipase gene (LIPC). (View Study)
- Age-related macular degeneration (GA): Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes. (View Study)
- Complement C3 and C4 levels: Genome-wide association study for serum complement C3 and C4 levels in healthy Chinese subjects. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
