c3c

Ensembl ID:
ENSDARG00000052207
ZFIN ID:
ZDB-GENE-990415-37
Description:
complement component c3c [Source:RefSeq peptide;Acc:NP_001032313]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12504 Essential Splice Site Available for shipment Available now
sa9572 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Essential Splice Site 198 1651 5 41
Genomic Location:
Chromosome 1 (position 56826350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAAAGGTGTGAARTCTTCRATCTACAACATCCCTGAGGTTACTAG[G/A]TGTGTAAATCACTGTTGGGACTAATACGATTCAMCTAGRGTTAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052683 Nonsense 1034 1651 24 41
Genomic Location:
Chromosome 1 (position 56850149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCTGGACAACACCAATCAGTGGGAATCTGTTGGCATTGACCGCCGT[A/T]AAGTTGCCATTAACCATATCAAAACAGGTCAGGATACAACAGATNNNNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/efmhqyqi