eif2s1

Ensembl ID:
ENSDARG00000052178
ZFIN ID:
ZDB-GENE-030131-283
Description:
eukaryotic translation initiation factor 2, subunit 1 alpha [Source:RefSeq peptide;Acc:NP_571875]
Human Orthologue:
EIF2S1
Human Description:
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa [Source:HGNC Symbol;Acc:3265]
Mouse Orthologue:
Eif2s1
Mouse Description:
eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI Symbol;Acc:MGI:95299]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23820 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073981 Essential Splice Site 158 315 4 8
Genomic Location:
Chromosome 20 (position 51447027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAGAAGCCTGGATACGGGGCCTACGACGTCTTTAAACAAGCTGTGTC[G/A]TGAGTCTAAGAGCACTAAAACACAAAAGCCCCTTTCACACATGCATCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t1o7aeit