shcbp1

Ensembl ID:
ENSDARG00000052167
ZFIN IDs:
ZDB-GENE-030131-5865, ZDB-GENE-030131-5865
Description:
SHC SH2 domain-binding protein 1 [Source:RefSeq peptide;Acc:NP_956137]
Human Orthologue:
SHCBP1
Human Description:
SHC SH2-domain binding protein 1 [Source:HGNC Symbol;Acc:29547]
Mouse Orthologue:
Shcbp1
Mouse Description:
Shc SH2-domain binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1338802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40975 Nonsense Mutation detected in F1 DNA During 2017
sa14341 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073964 Nonsense 288 721 6 13
ENSDART00000123767 Nonsense 299 732 8 15
Genomic Location (Zv9):
Chromosome 7 (position 42250253)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 45575477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTATGACATTTTGGAGGATCGTGTTCCAGCTGGTCTTGTAGCAGAGTA[T/G]CATTCATTGCTGGCGCTGTGCTCGGAGAAGTTTCAGGAGTTCTCCAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073964 Nonsense 657 721 13 13
ENSDART00000123767 Nonsense 668 732 15 15
Genomic Location (Zv9):
Chromosome 7 (position 42231782)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 45557040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAAGAATGCCCATCCATCAAATAYAGCTGCACARTTCCTCCAGACTG[T/A]GAAGGAAATGATGCCATCAAACAAGAGTTAGTTGCCACCTCGGCCAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link