si:ch211-236k19.8

Ensembl ID:
ENSDARG00000052154
ZFIN ID:
ZDB-GENE-060526-123
Description:
Novel protein similar to vertebrate Lix1 homolog (Mouse) like (LIX1L) [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
LIX1
Human Description:
Lix1 homolog (chicken) [Source:HGNC Symbol;Acc:18581]
Mouse Orthologue:
Lix1
Mouse Description:
limb expression 1 homolog (chicken) Gene [Source:MGI Symbol;Acc:MGI:1913893]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17265 Nonsense Available for shipment Available now
sa38523 Nonsense Mutation detected in F1 DNA During 2017
sa17184 Nonsense Available for shipment Available now
sa10387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 29 255 1 5
ENSDART00000140305 Nonsense 29 128 1 3
ENSDART00000144816 Nonsense 43 290 2 6
Genomic Location (Zv9):
Chromosome 5 (position 68401001)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64142501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAACAAGCAGCAGRCGTGATGATGGAGATRGAGAATCTGGTAGTGTA[T/G]GAGTCCATTCCTTCACCCAGTCCTCCATTCATATRCTACGTCACATTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 185 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 199 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68392096)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCGTCTGGACGAGCGCACGCGCAGCCACATGGCACTGGACTGGTTA[C/T]AGAAGGAGCTTCAGTCACCCGGCCTGCTGTCCCAGGAGCTGCAGCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68391946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATRTCCTGGAGAGAAGCWACTGAGTTWGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
ENSDART00000073951 Nonsense 235 255 5 5
ENSDART00000140305   None 128 None 3
ENSDART00000144816 Nonsense 249 290 6 6
Genomic Location (Zv9):
Chromosome 5 (position 68391946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64133446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGGAGAAGAAAGAAATCCTCAGTTTAGCTCTCAGTCATGCTGACGCC[G/T]AGGACCTGGAGGAGGAAATGTCCTGGAGAGAAGCWACTGAGTTTGACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link