ptgs1

Ensembl ID:
ENSDARG00000052148
ZFIN ID:
ZDB-GENE-020530-1
Description:
prostaglandin G/H synthase 1 [Source:RefSeq peptide;Acc:NP_705942]
Human Orthologue:
PTGS1
Human Description:
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) [Source:HGNC S
Mouse Orthologue:
Ptgs1
Mouse Description:
prostaglandin-endoperoxide synthase 1 Gene [Source:MGI Symbol;Acc:MGI:97797]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa53 Nonsense Confirmed mutation in F2 line During 2017
sa11791 Nonsense Available for shipment Available now
sa15398 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa53
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033890 Nonsense 69 597 4 12
ENSDART00000122863 Nonsense 69 597 3 11
Genomic Location (Zv9):
Chromosome 5 (position 68490195)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64231695
KASP Assay ID:
554-0028.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGATATGAATGTGACTGCACCAGAACGGGCTACTATGGAGAAAATTG[C/A]ACTATACGTATGTATCTTTTGTGTTTTTTTGTCTGTATATTTAGACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033890 Nonsense 159 597 6 12
ENSDART00000122863 Nonsense 159 597 5 11
Genomic Location (Zv9):
Chromosome 5 (position 68506241)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64247741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAACATCACCTACTACACCAGAATCCTACCGCCGGTCCCTAACGACTG[T/A]CCTACACCMATGGGAACCAAAGGTARGAGATAGAGTTCACCTCAKTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033890 Nonsense 396 597 10 12
ENSDART00000122863 Nonsense 396 597 9 11
Genomic Location (Zv9):
Chromosome 5 (position 68513986)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64255486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTCAATCAACTTTACCACTGGCACCCRCTCATGCCTGACAGCTTCTA[C/A]AWCGACGGAGACCWCATTCAGTACTCAAAGTTCATATTYAACACATCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link