notch3

Ensembl ID:
ENSDARG00000052139
ZFIN ID:
ZDB-GENE-000329-5
Description:
neurogenic locus notch homolog protein 3 [Source:RefSeq peptide;Acc:NP_571624]
Human Orthologue:
NOTCH3
Human Description:
notch 3 [Source:HGNC Symbol;Acc:7883]
Mouse Orthologue:
Notch3
Mouse Description:
Notch gene homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:99460]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33321 Nonsense Mutation detected in F1 DNA During 2017
sa14943 Essential Splice Site Available for shipment Available now
sa16743 Nonsense Available for shipment Available now
sa20147 Nonsense Available for shipment Available now
sa40169 Nonsense Mutation detected in F1 DNA During 2017
sa33320 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073930 Nonsense 14 2468 1 33
Genomic Location (Zv9):
Chromosome 3 (position 54197153)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53304468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAAAATATGGGGAATTACAGCCTTTGGATATTTTTGTCAATTTTATA[T/A]CTGGTGCACAACAGCGAAGGTAAGATGACTGATCCTTTTCTTCATTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073930 Essential Splice Site 511 2468 10 33
Genomic Location (Zv9):
Chromosome 3 (position 54180245)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53287560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNCACCGACCTAATGGATATGAATGCCGMTGTGCTGAAG[G/A]TAAGTTTATAAATCAATATATCAATGCAATTGTGTGTTTAAGGATCTATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073930 Nonsense 607 2468 12 33
Genomic Location (Zv9):
Chromosome 3 (position 54178688)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53286003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAACTGTGAAATCAACTTTGACGACTGTGCYAGCAACCCTTGTGACTA[C/A]GGAATTTGCAAAGATGGCATAAATCGCTATGAGTGTGTCWGCAAACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073930 Nonsense 1377 2468 24 33
Genomic Location (Zv9):
Chromosome 3 (position 54172611)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53279926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTATCCATTTTTTCACTGCCAGTGCACCAATGGCTGGAAAGGCAAA[C/T]GATGTGAACAGAAAACTGGGTCATCGGCTCCACTTCCTTCTCCTTGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073930 Nonsense 1384 2468 24 33
Genomic Location (Zv9):
Chromosome 3 (position 54172589)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53279904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGCACCAATGGCTGGAAAGGCAAACGATGTGAACAGAAAACTGGGT[C/A]ATCGGCTCCACTTCCTTCTCCTTGCCCTATTGCTGACTGCTTCAGCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073930 Nonsense 1497 2468 25 33
Genomic Location (Zv9):
Chromosome 3 (position 54172167)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53279482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCAGATGGACTCTGTGATCAAGGATGCAATACTGAAGAATGTGGCTG[G/A]GATGGACTGGATTGTGCAAGGAAGATTCCAGAAGACCTTGCTGAAGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link