gli3

Ensembl ID:
ENSDARG00000052131
ZFIN ID:
ZDB-GENE-041111-162
Description:
zinc finger protein GLI3 [Source:RefSeq peptide;Acc:NP_991291]
Human Orthologue:
GLI3
Human Description:
GLI family zinc finger 3 [Source:HGNC Symbol;Acc:4319]
Mouse Orthologue:
Gli3
Mouse Description:
GLI-Kruppel family member GLI3 Gene [Source:MGI Symbol;Acc:MGI:95729]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32478 Nonsense Available for shipment Available now
hu2965 Nonsense Confirmed mutation in F2 line Unknown
sa8416 Nonsense Mutation detected in F1 DNA During 2017
sa8870 Nonsense Mutation detected in F1 DNA During 2017
sa37838 Nonsense Mutation detected in F1 DNA During 2017
sa25210 Nonsense Mutation detected in F1 DNA During 2017
sa37837 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 560 1553 12 15
ENSDART00000123554 Nonsense 560 1553 11 14
Genomic Location (Zv9):
Chromosome 24 (position 11316447)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11403850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAATCTTGTTCATTTTTGTCCTTTTTTATCTCAGTTTGAAGGCTGTT[C/A]AAAGGCATATTCCAGATTAGAGAACCTGAAAACACATTTGCGTTCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2965
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 655 1553 13 15
ENSDART00000123554 Nonsense 655 1553 12 14
Genomic Location (Zv9):
Chromosome 24 (position 11311698)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11399101
KASP Assay ID:
554-0076.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTCCTGAAGCCCATGTCACCAAAAAACAACGTGGGGAGACATACCCA[C/T]GACCCCCACCTCAGCCACGAGAACCTGGAGCAACCACTGACCAAAAGGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 677 1553 13 15
ENSDART00000123554 Nonsense 677 1553 12 14
ENSDART00000058992 Nonsense 677 1553 13 15
ENSDART00000123554 Nonsense 677 1553 12 14
Genomic Location (Zv9):
Chromosome 24 (position 11311631)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11399034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGAAMCTGGAGCAACCACTGAYCAAAAGGAGTATACCCATGCTACCT[C/A]AAAACAGGATGAATGTCTGCAAGTCAAKTCAATCAAAACAGAAAAGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 677 1553 13 15
ENSDART00000123554 Nonsense 677 1553 12 14
ENSDART00000058992 Nonsense 677 1553 13 15
ENSDART00000123554 Nonsense 677 1553 12 14
Genomic Location (Zv9):
Chromosome 24 (position 11311631)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11399034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGAAMCTGGAGCAACCACTGAYCAAAAGGAGTATACCCATGCTACCT[C/A]AAAACAGGATGAATGTCTGCAAGTCAAKTCAATCAAAACAGAAAAGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 855 1553 15 15
ENSDART00000123554 Nonsense 855 1553 14 14
Genomic Location (Zv9):
Chromosome 24 (position 11304239)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11391642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCCTCCATGCCCTGAGCCGTCCAACACAGAGCTGACAATTCTGAGTT[T/A]GCTGCATGAACGACGGGACAGTAGTGGCAGCAACACTAGCTCAGCTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 1080 1553 15 15
ENSDART00000123554 Nonsense 1080 1553 14 14
Genomic Location (Zv9):
Chromosome 24 (position 11303564)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11390967
KASP Assay ID:
554-7352.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTTGCCACAAGTACGACATTTCAGTAGTTTAAACAATATGACTTCAT[C/A]ACCCAATCCTGCTAGTTATGGTTACTTAAACAGAGAAGATCACAGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058992 Nonsense 1390 1553 15 15
ENSDART00000123554 Nonsense 1390 1553 14 14
Genomic Location (Zv9):
Chromosome 24 (position 11302635)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11390038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACTAGGCAGGATATTAACAGCCATAATGTACAATCATGCCATCCA[C/T]AAAGCTTGAACAATAGACTAGGCACAAATTGTTCCCCTTCAAATCAGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link