rag1

Ensembl ID:
ENSDARG00000052122
ZFIN ID:
ZDB-GENE-990415-234
Description:
V(D)J recombination-activating protein 1Endonuclease RAG1E3 ubiquitin-protein ligase RAG1 [Source:Un
Human Orthologue:
RAG1
Human Description:
recombination activating gene 1 [Source:HGNC Symbol;Acc:9831]
Mouse Orthologue:
Rag1
Mouse Description:
recombination activating gene 1 Gene [Source:MGI Symbol;Acc:MGI:97848]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32518 Nonsense Available for shipment Available now
hu1999 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa32518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073913 Nonsense 790 1057 3 3
ENSDART00000142917 Nonsense 790 1057 4 4
Genomic Location (Zv9):
Chromosome 25 (position 9236192)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8930855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAATCTCGAGCGCTATGAGATCTGGAGGAAAAATCCCTTCTCAGAGT[C/A]AGCAGACGAACTGCGTGACCGAGTCAAAGGTGTTTCTGCTAAGCCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu1999
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073913 Nonsense 797 1057 3 3
ENSDART00000142917 Nonsense 797 1057 4 4
Genomic Location (Zv9):
Chromosome 25 (position 9236212)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8930875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCGAGCGCTATGAGATCTGGAGGAAAAATCCCTTCTCAGAGTCAGCAGACGAACTGCGTGAC[C/T]GAGTCAAAGGTGTTTCTGCTAAGCCTTTCATGGAAACCCAGCCTACTCTGGATGCACTGCACTGTGATATTGGCAATGCGACTGAATTCTACAAAATCTTTCAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link