CRTC3

Ensembl ID:
ENSDARG00000052114
Description:
CREB regulated transcription coactivator 3 [Source:HGNC Symbol;Acc:26148]
Human Orthologue:
CRTC3
Human Description:
CREB regulated transcription coactivator 3 [Source:HGNC Symbol;Acc:26148]
Mouse Orthologue:
Crtc3
Mouse Description:
CREB regulated transcription coactivator 3 Gene [Source:MGI Symbol;Acc:MGI:1917711]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41008 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9161 Nonsense Mutation detected in F1 DNA During 2016
sa5443 Nonsense F2 line generated During 2016
sa8737 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Essential Splice Site 223 631 7 15
Genomic Location (Zv9):
Chromosome 7 (position 52023141)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50293377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGGTGTGAATAAGCCAATGCCCAAACAACTATGGGAAGCCAAAAAG[G/A]TTGGTGCATGGGTACTTTGATTAATTGCAAAAAAAAGTAGTATTGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Nonsense 387 631 10 15
Genomic Location (Zv9):
Chromosome 7 (position 52019749)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50289985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCCTGACGCTCTCTCCAGGGGGAGATCAGAGGAGAAGCCTGAGCAAA[C/T]AGCTCTCGCCGACAATGTCGCCCTCTCTGTCTCCAATCACACAGGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5443
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Nonsense 428 631 11 15
Genomic Location (Zv9):
Chromosome 7 (position 52018132)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50288368
KASP Assay ID:
554-3503.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGGAGCCTCCTCCTCCTTACCCTCTTTACCAGCAAAGCCAGCAGCCA[C/T]AGCCTCCACAGTCCCATCAGGCCATTCAGCAGAGCTCCCAGCATCCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073903 Nonsense 494 631 13 15
Genomic Location (Zv9):
Chromosome 7 (position 52008798)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50279034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWTTTATGGAGCAGCAGTTCTCTGGACGTCAGTCAAAATGTTCAGCCTAT[C/T]AGGTAAACGTGCCTTTAGGGCAYTCCAAAGTTGACCCTCTTTTCCARACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link