mboat4

Ensembl ID:
ENSDARG00000052110
ZFIN ID:
ZDB-GENE-090421-3
Description:
Ghrelin O-acyltransferase [Source:UniProtKB/Swiss-Prot;Acc:B1Q006]
Human Orthologue:
MBOAT4
Human Description:
membrane bound O-acyltransferase domain containing 4 [Source:HGNC Symbol;Acc:32311]
Mouse Orthologue:
Mboat4
Mouse Description:
membrane bound O-acyltransferase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2685017]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12263 Essential Splice Site Available for shipment Available now
sa20579 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073895 Essential Splice Site 42 415 1 3
Genomic Location:
Chromosome 5 (position 69147919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTTCATTGCTTATCCAGTCAAGGAYATCTCTYGATAATCAACAGG[T/C]ACAGTAATGATAAATCCATTGTTCTTTRTCAGAACATATTTNNNNNNNNNNNNNNNAGGTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073895 Nonsense 45 415 2 3
Genomic Location:
Chromosome 5 (position 69147829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGTCACCTACTGAAAAAATGAAATTCATCTCTTGTAAGGTACGTCTA[T/A]TTGGCGATGGGAGGATTCATGCTGGCTATTGCAACAATGGGTCCATATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/osut82ga