agxta

Ensembl ID:
ENSDARG00000052099
ZFIN ID:
ZDB-GENE-040718-16
Description:
alanine-glyoxylate aminotransferase a [Source:RefSeq peptide;Acc:NP_001002331]
Human Orthologue:
AGXT
Human Description:
alanine-glyoxylate aminotransferase [Source:HGNC Symbol;Acc:341]
Mouse Orthologue:
Agxt
Mouse Description:
alanine-glyoxylate aminotransferase Gene [Source:MGI Symbol;Acc:MGI:1329033]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7041 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2341 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 54 391 2 11
Genomic Location:
Chromosome 6 (position 26827474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATAAAATGAGACTGTTTTATTAATAATTCGTTCTGATTTTGCTTTC[A/G]GATTATGAATCAGATAAAGAGCGGCATTCAGTATGCGTTTCAAACCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Nonsense 232 391 7 11
Genomic Location:
Chromosome 6 (position 26823853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACATCTTTTTTTNNNTTGTTTTGGAAAACAGCCACAAAATATTTAATAGG[A/T]AAACAAAACCAATCTCTTACTTCTTGGACTTRAACTGGTTGGCRAATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/72glvt2v