agxta

Ensembl ID:
ENSDARG00000052099
ZFIN ID:
ZDB-GENE-040718-16
Description:
alanine-glyoxylate aminotransferase a [Source:RefSeq peptide;Acc:NP_001002331]
Human Orthologue:
AGXT
Human Description:
alanine-glyoxylate aminotransferase [Source:HGNC Symbol;Acc:341]
Mouse Orthologue:
Agxt
Mouse Description:
alanine-glyoxylate aminotransferase Gene [Source:MGI Symbol;Acc:MGI:1329033]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7041 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26748 Essential Splice Site Mutation detected in F1 DNA During 2015
sa2341 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa7041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 54 391 2 11
Genomic Location:
Chromosome 6 (position 26827474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATAAAATGAGACTGTTTTATTAATAATTCGTTCTGATTTTGCTTTC[A/G]GATTATGAATCAGATAAAGAGCGGCATTCAGTATGCGTTTCAAACCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Essential Splice Site 196 391 5 11
Genomic Location:
Chromosome 6 (position 26824123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCAGTAGCAGCATTGGGAGGTGCTCCTATCTGTATGGATGAACAAG[G/A]TATCGTCACACTTTATTCTGTGGTAGCACAATCCTTAACTTTGGTCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073881 Nonsense 232 391 7 11
Genomic Location:
Chromosome 6 (position 26823853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACATCTTTTTTTNNNTTGTTTTGGAAAACAGCCACAAAATATTTAATAGG[A/T]AAACAAAACCAATCTCTTACTTCTTGGACTTRAACTGGTTGGCRAATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/72glvt2v