si:ch211-106h11.4

Ensembl ID:
ENSDARG00000052097
ZFIN ID:
ZDB-GENE-061009-3
Description:
hypothetical protein LOC560122 [Source:RefSeq peptide;Acc:NP_001103855]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39979 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057464 Nonsense 363 455 5 5
Genomic Location (Zv9):
Chromosome 3 (position 6057189)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5629632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGGTGAAGGAGAGTCGATGCTGGAGTGTCGGAGTAACTACAGCGT[C/A]AAACCAGAGGAAGAGAGATGTTTTCTTTAACACTGATGTGTGGAGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link