notch1b

Ensembl ID:
ENSDARG00000052094
ZFIN ID:
ZDB-GENE-990415-183
Description:
neurogenic locus notch homolog protein 1 [Source:RefSeq peptide;Acc:NP_571377]
Human Orthologue:
NOTCH1
Human Description:
notch 1 [Source:HGNC Symbol;Acc:7881]
Mouse Orthologue:
Notch1
Mouse Description:
Notch gene homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97363]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1187 Essential Splice Site F2 line generated During 2017
sa26617 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26616 Nonsense Mutation detected in F1 DNA During 2017
sa11236 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1187
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050855 Essential Splice Site 44 2465 2 34
ENSDART00000050856   None 1817 None 22
ENSDART00000130888 Essential Splice Site 2 2436 2 34
Genomic Location (Zv9):
Chromosome 5 (position 68766852)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65099074
KASP Assay ID:
554-1096.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACGGAGGCACATGTGAACCAACTGCAGACGGGAGAGGAGAATGCAAG[T/A]AAGTGATAAGATTCTCGACTGCATGATATTGCTGTGTCTGATACCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050855 Essential Splice Site 539 2465 11 34
ENSDART00000050856   None 1817 None 22
ENSDART00000130888 Essential Splice Site 470 2436 10 34
Genomic Location (Zv9):
Chromosome 5 (position 68714956)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65047178
KASP Assay ID:
2259-6806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGGAATGAAGCTGGAGGAATTATTGTAATGACCTTCTTTTTTTGT[A/T]GGATTTTCGGGGAGCCAATGCCAGTTCGACATTGACGAGTGCGCTAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050855 Nonsense 1088 2465 20 34
ENSDART00000050856 Nonsense 439 1817 8 22
ENSDART00000130888 Nonsense 1059 2436 20 34
Genomic Location (Zv9):
Chromosome 5 (position 68696569)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65028791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATACTGTGACGTTCCCAGTGTTTCCTGCGAGGTGGCCGCCAAACAG[C/T]AAGGTTTGTTTATATGAATGGGCCTATTACAGTTAAAGTCAAATTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050855 Nonsense 1149 2465 21 34
ENSDART00000050856 Nonsense 500 1817 9 22
ENSDART00000130888 Nonsense 1120 2436 21 34
Genomic Location (Zv9):
Chromosome 5 (position 68695835)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65028057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCRTGCCAGAACGGAGCAACTTGCACCGACTACCTGGGCGGATACTCCTG[T/A]GAAGTMAGTCAAGAGGATCTGGAAGTTRGCAATCATCTTCACTGTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link