rbpjb

Ensembl ID:
ENSDARG00000052091
ZFIN ID:
ZDB-GENE-070319-1
Description:
recombining binding protein suppressor of hairless [Source:RefSeq peptide;Acc:NP_001077020]
Human Orthologue:
RBPJ
Human Description:
recombination signal binding protein for immunoglobulin kappa J region [Source:HGNC Symbol;Acc:5724]
Mouse Orthologues:
Rbpj, Rbpsuh-rs3
Mouse Descriptions:
recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:M
recombining binding protein suppressor of hairless (Drosophila), related sequence 3 Pseudogene [Sour

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8403 Nonsense Mutation detected in F1 DNA During 2017
sa34217 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092580 Nonsense 26 491 3 11
Genomic Location (Zv9):
Chromosome 7 (position 62818943)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61866141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGTTTCCTTTCTTTCTGCNTATTTTYCAGAGAAGCCATGCGAAATTA[C/A]CTGAAGGAACGAGGAGACCAAACTGTGCTCATCCTACACGCTAAAGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092580 Essential Splice Site 383 491 10 11
Genomic Location (Zv9):
Chromosome 7 (position 62846168)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61893366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACTCTGCGGGTGTGGTTTGGTGATGTAGAGGCAGAGACCATGTACAG[G/A]TATAGATTTGAGAAGATATACATATATGTATTGTTACGTCCTATAAAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link