LOC797181

Ensembl ID:
ENSDARG00000052088
Human Orthologues:
CXCR1, CXCR2
Human Descriptions:
chemokine (C-X-C motif) receptor 1 [Source:HGNC Symbol;Acc:6026]
chemokine (C-X-C motif) receptor 2 [Source:HGNC Symbol;Acc:6027]
Mouse Orthologues:
Cxcr1, Cxcr2
Mouse Descriptions:
chemokine (C-X-C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2448715]
chemokine (C-X-C motif) receptor 2 Gene [Source:MGI Symbol;Acc:MGI:105303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073870 Nonsense 174 364 2 2
Genomic Location:
Chromosome 9 (position 49076084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRRAAGGCCCAAAGAAGACTCTGCAGTGGAGTCGCKTGCGGATTAGTTTG[G/A]GTTTTGGGTTTAGTGCTCTCACTGCCGTCATTCTACAACGAGGCGTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r4baqnix