B1H1J5_DANRE

Ensembl ID:
ENSDARG00000052074
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B1H1J5]
Human Orthologue:
CTSA
Human Description:
cathepsin A [Source:HGNC Symbol;Acc:9251]
Mouse Orthologue:
Ctsa
Mouse Description:
cathepsin A Gene [Source:MGI Symbol;Acc:MGI:97748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17141 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073846 Nonsense 121 461 3 11
Genomic Location:
Chromosome 7 (position 53272796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTTTACGAGAATGAGTTCAGCTGGAATAAAATTGCCAATGTTTTGTA[T/A]ATTGAGTCRCCTGCTGGAGTGGGTTATTCCTACTCCGATGACCAAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j7e8vppm