IRS4 (1 of 2)

Ensembl ID:
ENSDARG00000052065
Description:
insulin receptor substrate 4 [Source:HGNC Symbol;Acc:6128]
Human Orthologue:
IRS4
Human Description:
insulin receptor substrate 4 [Source:HGNC Symbol;Acc:6128]
Mouse Orthologue:
Irs4
Mouse Description:
insulin receptor substrate 4 Gene [Source:MGI Symbol;Acc:MGI:1338009]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008328 Nonsense 148 1070 1 3
Genomic Location:
Chromosome 7 (position 52703740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGCAGGAGCAGGAGGAGTGGTACCAGGCGCTGAGCGAGCTCATGAGT[G/T]AGAGGAAGAGGGGACACTTGGATGCAGAGGACATTGACGATGGATACGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4fzp63nm