LOC571079

Ensembl ID:
ENSDARG00000052064
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10791 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104453 Nonsense 159 621 2 14
Genomic Location:
Chromosome 25 (position 19235479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTCTAGCAGATGAAAACAGCAACTTCCCTCGTGGCACCAAMAGCTG[G/A]GTCGCAGGCTGGGGGGATATTGGARTTTTGGGCACAGGTGGTATAAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2l5bzevm