LOC571079

Ensembl ID:
ENSDARG00000052064
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10791 Nonsense Available for shipment Available now
sa44273 Nonsense Mutation detected in F1 DNA During 2016
sa44272 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38050 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104453 Nonsense 159 621 2 14
Genomic Location (Zv9):
Chromosome 25 (position 19235479)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18647456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTCTAGCAGATGAAAACAGCAACTTCCCTCGTGGCACCAAMAGCTG[G/A]GTCGCAGGCTGGGGGGATATTGGARTTTTGGGCACAGGTGGTATAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104453 Nonsense 192 621 2 14
Genomic Location (Zv9):
Chromosome 25 (position 19235382)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18647359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAGAACCACAGTGTCTGTGCCTTTACCTCATCCTGGCATTCTGCAA[G/T]AGGCTGAGCTTAAAGTGTACAGTAATGCAGACTGCAATAATATTTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104453 Essential Splice Site 300 621 7 14
Genomic Location (Zv9):
Chromosome 25 (position 19231716)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18643693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATTTAAACAATGCAGCTTAAACAGTCATAATTTCAGGTTTGTGTTT[C/T]GAAAAAAGATTTAGAAATAAAACAACGGAAAAAGAGCCTGGGAACTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104453 Essential Splice Site 432 621 12 14
Genomic Location (Zv9):
Chromosome 25 (position 19220790)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18632767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTAAACATTAGCCACTTGTAATTCATTGTGTTCTTCATGGTCCGTA[T/A]TCAGTGTCATCACGTCGAGTGTGCTTGTGTACTTGGGAAGAAGGACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link