col4a5

Ensembl ID:
ENSDARG00000052063
ZFIN ID:
ZDB-GENE-030131-2281
Description:
collagen alpha-5(IV) chain [Source:RefSeq peptide;Acc:NP_001116702]
Human Orthologue:
COL4A5
Human Description:
collagen, type IV, alpha 5 [Source:HGNC Symbol;Acc:2207]
Mouse Orthologue:
Col4a5
Mouse Description:
collagen, type IV, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:88456]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27050 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1609 Essential Splice Site Available for shipment Available now
sa34181 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41016 Nonsense Mutation detected in F1 DNA During 2016
sa21069 Nonsense Mutation detected in F1 DNA During 2016
sa16790 Essential Splice Site Available for shipment Available now
sa41017 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Essential Splice Site 127 1659 6 49
ENSDART00000108738 Essential Splice Site 101 1633 5 48
Genomic Location (Zv9):
Chromosome 7 (position 52602530)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50872280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGGTGCTCCAGGACCCAGAGGAATTCCAGGCTGTAATGGAACTAAA[G/A]TATGAAACACTACAAACAATCATTGAACAGACAATATAAGCTGAAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Essential Splice Site 259 1659 13 49
ENSDART00000108738 Essential Splice Site 233 1633 12 48
Genomic Location (Zv9):
Chromosome 7 (position 52607601)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50877351
KASP Assay ID:
554-1550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGTGAAGTGTCAGGTTCACCAGATACAGTCATTCAACAAGGAGAAAAG[G/T]TATTCTTACCTCTTTGCTTCAATATGTTTTGACTCAYAGCCCAAGGAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Essential Splice Site 388 1659 20 49
ENSDART00000108738 Essential Splice Site 362 1633 19 48
Genomic Location (Zv9):
Chromosome 7 (position 52615921)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50885671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTTTGGTAGGTATTCAGGGGCCACCTGGTCCACAGGGTCCTCCAGG[T/C]AAGTGGCATTTATTAATTATTATTACTATTTTGTTATTTTTAAGCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Nonsense 672 1659 26 49
ENSDART00000108738 Nonsense 646 1633 25 48
Genomic Location (Zv9):
Chromosome 7 (position 52621071)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50890821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGTTGGTGAACGTGGACCCCCAGGACAGGATGGAGATCCTGGTTCA[C/T]AAGGACGTCCAGGTATAGAATATAATTACCTATCTCACTACGCTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Nonsense 926 1659 33 49
ENSDART00000108738 Nonsense 900 1633 32 48
Genomic Location (Zv9):
Chromosome 7 (position 52624808)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50894558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTATCATACTATTGCTTTACAGGAGATGATGGTGTCCCAGGACAGT[C/A]AGGAAATCCAGGTTTTCCAGGGTTAAAAGGAGACAAAGGTGAAACAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Essential Splice Site 1249 1659 39 49
ENSDART00000108738 Essential Splice Site 1223 1633 38 48
Genomic Location (Zv9):
Chromosome 7 (position 52626607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50896357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGGACCTAAAGGTATCCAAGGTCCACCTGGTCCCCCCGGAAGAGCTG[G/A]TAAAGTCGAWATATTATATTACCTTTTGTYCAGGTCTGCCTTCTGGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Nonsense 1562 1659 47 49
ENSDART00000108738 Nonsense 1536 1633 46 48
Genomic Location (Zv9):
Chromosome 7 (position 52642049)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50911799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGTGATTGCTGTACACAGTCAGACCATTCAGTTGCCAGCGTGCCCT[G/T]AAAACTGGGATACCCTCTGGATCGGTTACTCCTTCATGATGGTACGTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link