col4a5

Ensembl ID:
ENSDARG00000052063
ZFIN ID:
ZDB-GENE-030131-2281
Description:
collagen alpha-5(IV) chain [Source:RefSeq peptide;Acc:NP_001116702]
Human Orthologue:
COL4A5
Human Description:
collagen, type IV, alpha 5 [Source:HGNC Symbol;Acc:2207]
Mouse Orthologue:
Col4a5
Mouse Description:
collagen, type IV, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:88456]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1609 Essential Splice Site Available for shipment Available now
sa21069 Nonsense Mutation detected in F1 DNA During 2014
sa16790 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Essential Splice Site 259 1659 13 49
ENSDART00000108738 Essential Splice Site 233 1633 12 48
Genomic Location:
Chromosome 7 (position 52607601)
KASP Assay ID:
554-1550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGTGAAGTGTCAGGTTCACCAGATACAGTCATTCAACAAGGAGAAAAG[G/T]TATTCTTACCTCTTTGCTTCAATATGTTTTGACTCAYAGCCCAAGGAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Nonsense 926 1659 33 49
ENSDART00000108738 Nonsense 900 1633 32 48
Genomic Location:
Chromosome 7 (position 52624808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTATCATACTATTGCTTTACAGGAGATGATGGTGTCCCAGGACAGT[C/A]AGGAAATCCAGGTTTTCCAGGGTTAAAAGGAGACAAAGGTGAAACAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073827 Essential Splice Site 1249 1659 39 49
ENSDART00000108738 Essential Splice Site 1223 1633 38 48
Genomic Location:
Chromosome 7 (position 52626607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGGACCTAAAGGTATCCAAGGTCCACCTGGTCCCCCCGGAAGAGCTG[G/A]TAAAGTCGAWATATTATATTACCTTTTGTYCAGGTCTGCCTTCTGGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ofm0u3tp