col4a6

Ensembl ID:
ENSDARG00000052061
ZFIN ID:
ZDB-GENE-101001-2
Description:
Type IV collagen alpha 6 chain [Source:UniProtKB/TrEMBL;Acc:Q4TZW7]
Human Orthologue:
COL4A6
Human Description:
collagen, type IV, alpha 6 [Source:HGNC Symbol;Acc:2208]
Mouse Orthologue:
Col4a6
Mouse Description:
collagen, type IV, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:2152695]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7085 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121574 Essential Splice Site 90 1666 4 44
Genomic Location:
Chromosome 7 (position 52431370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGGCCATATAGGACGTAAAGGTCCTCCTGGACAAAATGGAGATAAG[G/A]TCAGCTTACTGTGGCACATGYGTGGACTTCTATTGCAGATTTMATTTTYT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt29j7ei