col4a6

Ensembl ID:
ENSDARG00000052061
ZFIN ID:
ZDB-GENE-101001-2
Description:
Type IV collagen alpha 6 chain [Source:UniProtKB/TrEMBL;Acc:Q4TZW7]
Human Orthologue:
COL4A6
Human Description:
collagen, type IV, alpha 6 [Source:HGNC Symbol;Acc:2208]
Mouse Orthologue:
Col4a6
Mouse Description:
collagen, type IV, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:2152695]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34180 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7085 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41015 Nonsense Mutation detected in F1 DNA During 2016
sa41014 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121574 Essential Splice Site 4 1666 1 44
Genomic Location (Zv9):
Chromosome 7 (position 52557306)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50827056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTACTTTACCTGCTGTTTCCTCAAAGCTTTGCAAAATGAGACTTTGG[T/C]AAGTTTATCATATCTTCAGATGTCATTTTTAGCTATTAGAAGTTGTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121574 Essential Splice Site 90 1666 4 44
Genomic Location (Zv9):
Chromosome 7 (position 52431370)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50701120
KASP Assay ID:
554-4354.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGGCCATATAGGACGTAAAGGTCCTCCTGGACAAAATGGAGATAAG[G/A]TCAGCTTACTGTGGCACATGYGTGGACTTCTATTGCAGATTTMATTTTYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121574 Nonsense 122 1666 6 44
Genomic Location (Zv9):
Chromosome 7 (position 52430912)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50700662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACCCTGGTCAGGAGGGGCCCAGGGGGCCTCCAGGTCTGGATGGGTG[T/A]AATGGCACACAAGGGGACACTGGTTACAGCGGCCTTGATGGGTATTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121574 Essential Splice Site 1024 1666 31 44
Genomic Location (Zv9):
Chromosome 7 (position 52388683)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50658433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGGATCTTGTTTGTTGTATTTTTATATTTTATGTTGTTCTTATCTGT[A/G]GGGTGATAATGGTGTCCCTGGGGTTCCTGGGTTCCCGGGTGCTCAAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link