PAQR9

Ensembl ID:
ENSDARG00000052059
Description:
progestin and adipoQ receptor family member IX [Source:HGNC Symbol;Acc:30131]
Human Orthologue:
PAQR9
Human Description:
progestin and adipoQ receptor family member IX [Source:HGNC Symbol;Acc:30131]
Mouse Orthologue:
Paqr9
Mouse Description:
progestin and adipoQ receptor family member IX Gene [Source:MGI Symbol;Acc:MGI:1922802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34179 Nonsense Mutation detected in F1 DNA During 2017
sa41013 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073815 Nonsense 154 306 2 3
Genomic Location (Zv9):
Chromosome 7 (position 52337071)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50606821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTCGAGAAATTTGTTTTTTTGTGGACTACGGGACTATCAGTGCATA[T/A]ACAGTGGGTTCCTCATTGGCGTATTTCTACTACATCCATCCTCAAGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073815 Nonsense 183 306 3 3
Genomic Location (Zv9):
Chromosome 7 (position 52336882)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50606632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACACAGGTCCAGCTGTTCTTTGAAAGCCTCTACATCCCATCCACCTG[T/A]CTGGTTGCCATCATTTGCGTCCTCACCTGCTGCAACACCAGACAGCGTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link