im:7147241

Ensembl ID:
ENSDARG00000052046
ZFIN ID:
ZDB-GENE-050208-274
Description:
Im:7147241 protein [Source:UniProtKB/TrEMBL;Acc:Q56A51]
Human Orthologue:
SEC16B
Human Description:
SEC16 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:30301]
Mouse Orthologue:
Sec16b
Mouse Description:
SEC16 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2148802]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25333 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15923 Nonsense Available for shipment Available now
sa18286 Nonsense Available for shipment Available now
sa20682 Essential Splice Site Mutation detected in F1 DNA During 2014
sa145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Essential Splice Site 156 935 3 24
Genomic Location:
Chromosome 6 (position 20071218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACTGACGCAGGAGTCTGCAAGAGCTTCATACTCCGATCAGCAGGGG[T/A]CTGTCAATGACTTGTTCTCATACGCTAATACTGTCAATCTAATGATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 216 935 5 24
Genomic Location:
Chromosome 6 (position 20067527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGTCTTCAAGCAGCTATGAGCTCAGTCAGTATATGAATGGAGCTGAA[C/T]AGAGTGAGCTWGAGCTCAKTTCTCACACAGGTTTGTCAGAACCACAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 492 935 12 24
Genomic Location:
Chromosome 6 (position 20052755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTWCYGTATTTCTTWGCAGTCCTGGAGTAGTGAGAAGTGGGGAGACT[G/A]GCGAYCACACYTGGCTGTTATGCTGTCCAATGAGACAACRGACCCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Essential Splice Site 522 935 13 24
Genomic Location:
Chromosome 6 (position 20052579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATTAAATAATTAATGAAGAGTTTTTTACTCTAATGTTTTCATCTCA[G/A]CCTCCAGGGATATGCTGTTTGCTTCACACATTTGCTACCTCACGGCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073789 Nonsense 596 935 15 24
Genomic Location:
Chromosome 6 (position 20047686)
KASP Assay ID:
554-0037.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTTATCTATTGCATATTTATTCATCTGTTGTTTTCCATKTAGGTGTA[T/A]AAATTCCTGTATGCATGCCGGCTGCTGGACTGTGGGCTCGTTTCTCAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
  • Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)
  • Schizophrenia: A comprehensive family-based replication study of schizophrenia genes. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hgi09ym8