ggt5

Ensembl ID:
ENSDARG00000052045
ZFIN ID:
ZDB-GENE-080226-1
Description:
gamma-glutamyltransferase 5 [Source:RefSeq peptide;Acc:NP_001116770]
Human Orthologue:
GGT5
Human Description:
gamma-glutamyltransferase 5 [Source:HGNC Symbol;Acc:4260]
Mouse Orthologue:
Ggt5
Mouse Description:
gamma-glutamyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1346063]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41269 Nonsense Mutation detected in F1 DNA During 2017
sa21354 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073782 Nonsense 65 556 2 12
ENSDART00000134452 Nonsense 65 539 2 12
Genomic Location (Zv9):
Chromosome 8 (position 41955028)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39968608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCATTCATTCTTTCTTTCTCCCAGAGATATCCTGCAGTCTGGTGGAT[C/A]AGCGGTAGATGGCGCCATCGCTACTTTACTGTGCACGTCAGTCATAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073782 Essential Splice Site 99 556 2 12
ENSDART00000134452 Essential Splice Site 99 539 2 12
Genomic Location (Zv9):
Chromosome 8 (position 41955133)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39968713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATGGGCATCGGCGGAGGCTCTATATTCACAATACGGGAACCAAATG[G/C]TTCGGATTGTTTTACTCTTAATTCCATAGGTTCATTTCTTTCTTATTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link