pomgnt1

Ensembl ID:
ENSDARG00000052025
ZFIN ID:
ZDB-GENE-070112-991
Description:
O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase 1 [Source:RefSeq peptide;Acc:NP_001036152
Human Orthologue:
POMGNT1
Human Description:
protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:19139]
Mouse Orthologue:
Pomgnt1
Mouse Description:
protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33888 Nonsense Mutation detected in F1 DNA During 2017
sa809 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073755 Nonsense 336 653 11 22
ENSDART00000122242 Nonsense 93 233 4 10
ENSDART00000130973 Nonsense 336 657 10 22
Genomic Location (Zv9):
Chromosome 6 (position 32784509)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33102174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCATGGTGTCAATCCACAGATGATCACTGTTTTTATTGATGGATATTA[T/A]GAGGTTACATCTGCTTTTCAGATTTTTATATTCTTTTTAAGTACGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073755 Nonsense 453 653 16 22
ENSDART00000122242 Nonsense 210 233 9 10
ENSDART00000130973 Nonsense 453 657 15 22
Genomic Location (Zv9):
Chromosome 6 (position 32787111)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33104776
KASP Assay ID:
554-0714.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTGGAAAGCATGCCTGGCMTTGGCTGGGTGCTTAAAAAGAGCCTTTA[C/A]AAGGATGAGCTGGAACCCAAATGGCCGACTCCTGAGAAGGTGAGCCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link