rtn4rl2a

Ensembl ID:
ENSDARG00000052012
ZFIN ID:
ZDB-GENE-040310-4
Description:
reticulon 4 receptor-like 2 a [Source:RefSeq peptide;Acc:NP_982346]
Human Orthologue:
RTN4RL2
Human Description:
reticulon 4 receptor-like 2 [Source:HGNC Symbol;Acc:23053]
Mouse Orthologue:
Rtn4rl2
Mouse Description:
reticulon 4 receptor-like 2 Gene [Source:MGI Symbol;Acc:MGI:2669796]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073736 Nonsense 342 458 3 3
Genomic Location (Zv9):
Chromosome 1 (position 44948590)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43791809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCCCTGGCTGGCACCACCACCACCACCTTCAGCACCAAGACCCGCTG[G/A]TGGTTCTCCAAGAACAAGCCTGTCAGCACCTCCAAAGGTATCTTTGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link