rrad

Ensembl ID:
ENSDARG00000052011
ZFIN ID:
ZDB-GENE-030131-5607
Description:
GTP-binding protein RAD [Source:RefSeq peptide;Acc:NP_956092]
Human Orthologue:
RRAD
Human Description:
Ras-related associated with diabetes [Source:HGNC Symbol;Acc:10446]
Mouse Orthologue:
Rrad
Mouse Description:
Ras-related associated with diabetes Gene [Source:MGI Symbol;Acc:MGI:1930943]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073735 Nonsense 276 300 5 5
Genomic Location:
Chromosome 7 (position 45948949)
KASP Assay ID:
554-1927.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCAAGCGKCGTGAGAGCATCAGCAAAAAGGCCAAACRTTTCCTGGGC[C/T]GAATGGTGGCCCGCAAGAACAAGAAGATGGCCTTCAGACAGAAATCCAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/31o8k8g7