ndufs8a

Ensembl ID:
ENSDARG00000051986
ZFIN ID:
ZDB-GENE-040426-2153
Description:
NADH dehydrogenase [Source:RefSeq peptide;Acc:NP_998304]
Human Orthologue:
NDUFS8
Human Description:
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) [Source:HGNC Symbo
Mouse Orthologue:
Ndufs8
Mouse Description:
NADH dehydrogenase (ubiquinone) Fe-S protein 8 Gene [Source:MGI Symbol;Acc:MGI:2385079]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19550 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059227 Essential Splice Site None 210 1 7
Genomic Location (Zv9):
Chromosome 1 (position 45269871)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44113090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAGTCGTCCGCTGTTCTGGTTGAGAAGGCCAAATAGCGAGTGTCTGG[T/C]GAGTGAGAGCTCATTTTTAAACTCACTGCATTCGTGGTCTGTTCTTTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link