ENSDARG00000051970

Ensembl ID:
ENSDARG00000051970
Human Orthologue:
SMU1
Human Description:
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) [Source:HGNC Symbol;Acc:18247]
Mouse Orthologue:
Smu1
Mouse Description:
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915546]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18504 Nonsense Available for shipment Available now
sa15438 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Nonsense 167 539 4 13
Genomic Location:
Chromosome 1 (position 45494371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGAGGTCTGTTTGGTGCCCCCTTCTCGTCTCATGGGTCTTCTTGGY[C/T]AGGTTTGACACCTTTCATTTCTTTTCTTTTTTTNTCTAACCTGTTGCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Essential Splice Site 400 539 10 13
Genomic Location:
Chromosome 1 (position 45477528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACGACGGCCAGCATGTCATTAGCGCWTCGGCGGACGGCACGGTAAAA[G/A]TATGTWTTCACACTGTAGTGTCCWGCCTTTACTAGTCTTTGCCTTTCASA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c9wympda