ENSDARG00000051970

Ensembl ID:
ENSDARG00000051970
Human Orthologue:
SMU1
Human Description:
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) [Source:HGNC Symbol;Acc:18247]
Mouse Orthologue:
Smu1
Mouse Description:
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915546]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18504 Nonsense Available for shipment Available now
sa32737 Nonsense Mutation detected in F1 DNA During 2016
sa15438 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Nonsense 167 539 4 13
Genomic Location (Zv9):
Chromosome 1 (position 45494371)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44337590
KASP Assay ID:
2259-0946.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGAGGTCTGTTTGGTGCCCCCTTCTCGTCTCATGGGTCTTCTTGGY[C/T]AGGTTTGACACCTTTCATTTCTTTTCTTTTTTTNTCTAACCTGTTGCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Nonsense 383 539 10 13
Genomic Location (Zv9):
Chromosome 1 (position 45477580)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44320799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGAAGGAGTTTAGAGGCCACACAGCTCATGTAAACGATGTCATCTA[C/A]TCGCACGACGGCCAGCATGTCATTAGCGCATCGGCGGACGGCACGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Essential Splice Site 400 539 10 13
Genomic Location (Zv9):
Chromosome 1 (position 45477528)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44320747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACGACGGCCAGCATGTCATTAGCGCWTCGGCGGACGGCACGGTAAAA[G/A]TATGTWTTCACACTGTAGTGTCCWGCCTTTACTAGTCTTTGCCTTTCASA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link