btr01

Ensembl ID:
ENSDARG00000051965
ZFIN ID:
ZDB-GENE-090511-2
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14479 Nonsense Available for shipment Available now
sa19552 Essential Splice Site Available for shipment Available now
sa32738 Nonsense Mutation detected in F1 DNA During 2016
sa39670 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073689 Nonsense 202 565 1 6
Genomic Location (Zv9):
Chromosome 1 (position 45520048)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44363267
KASP Assay ID:
2259-0948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACTGACCTRATGYGTATTTGCGCAGTGTGTGCAGAGAGCGAACATTA[C/A]GGCCATACTGTGACRGAGGCCAAGAGAGAGATGAATATTCGGAAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073689 Essential Splice Site 217 565 1 6
Genomic Location (Zv9):
Chromosome 1 (position 45520094)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44363313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACGGCCATACTGTGACGGAGGCCAAGAGAGAGATGAATATTCGGAAG[G/A]TAAGCACATTTATACGGTTGAAGTCAAAATTATTATTTTCATTTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073689 Nonsense 254 565 3 6
Genomic Location (Zv9):
Chromosome 1 (position 45526046)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44369265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTATAGCTGTTTTATGTCTTTCGCTTGCTGTAAGGTGAATGCGGAA[C/T]GAGAGAAAGCAGGCACCATCAGTATGTTTGCTGAATTAATGAAATCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073689 Essential Splice Site 377 565 4 6
Genomic Location (Zv9):
Chromosome 1 (position 45528394)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44371613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGGTGGAGGAGGTTCGACAAGGCCTGAGGAGACTCTCGGAGATCTG[T/C]AAGAGAAACTGCTCTTCAACTCATTGTAAAACATGATGTGATCAATAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link