btr01

Ensembl ID:
ENSDARG00000051965
ZFIN ID:
ZDB-GENE-090511-2
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14479 Nonsense Available for shipment Available now
sa19552 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073689 Nonsense 202 565 1 6
Genomic Location:
Chromosome 1 (position 45520048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACTGACCTRATGYGTATTTGCGCAGTGTGTGCAGAGAGCGAACATTA[C/A]GGCCATACTGTGACRGAGGCCAAGAGAGAGATGAATATTCGGAAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073689 Essential Splice Site 217 565 1 6
Genomic Location:
Chromosome 1 (position 45520094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACGGCCATACTGTGACGGAGGCCAAGAGAGAGATGAATATTCGGAAG[G/A]TAAGCACATTTATACGGTTGAAGTCAAAATTATTATTTTCATTTTTTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w05ac7gg