MMP15 (2 of 2)

Ensembl ID:
ENSDARG00000051962
Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Human Orthologue:
MMP15
Human Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Mouse Orthologue:
Mmp15
Mouse Description:
matrix metallopeptidase 15 Gene [Source:MGI Symbol;Acc:MGI:109320]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13887 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073684 Essential Splice Site 468 651 8 10
Genomic Location:
Chromosome 25 (position 17922222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTGTGGTGGGAGCCATCTGGATATAYGTACTTCTTCAGAGGAGACRGG[T/C]AAACAATWCTGGGGCCCTCGCTGAAAAGACCAGATGTGTGAAGTGCTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ciixfrr6