brms1

Ensembl ID:
ENSDARG00000051955
ZFIN ID:
ZDB-GENE-030616-596
Description:
breast cancer metastasis-suppressor 1 [Source:RefSeq peptide;Acc:NP_956391]
Human Orthologue:
BRMS1
Human Description:
breast cancer metastasis suppressor 1 [Source:HGNC Symbol;Acc:17262]
Mouse Orthologue:
Brms1
Mouse Description:
breast cancer metastasis-suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2388804]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34210 Nonsense Mutation detected in F1 DNA During 2017
sa21110 Essential Splice Site, Missense Available for shipment Available now
sa31610 Essential Splice Site, Missense Available for shipment Available now
sa7095 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073673 Nonsense 177 265 6 7
ENSDART00000073675 Nonsense 177 271 6 10
ENSDART00000121545 Nonsense 177 271 6 10
ENSDART00000126714 Nonsense 153 314 6 11
Genomic Location (Zv9):
Chromosome 7 (position 60884210)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60103175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCGAGTCTGTAATAAGATGCTTGTTTCTGTAGAGTGAGAAAACCCTTT[T/A]GTTTGATGCCATGAAGACAGAACTTTTGGAGAAGATCCGCAGACTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073673 Missense 226 265 7 7
ENSDART00000073675 Essential Splice Site 256 271 None 10
ENSDART00000121545 Essential Splice Site 256 271 None 10
ENSDART00000126714 Essential Splice Site 232 314 None 11
Genomic Location (Zv9):
Chromosome 7 (position 60887114)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60106079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCTAAGAGAAACTGACATACTAGAGGACTGGACAGCCATCAAGAAGG[T/C]ATTAATTATGAGTTATCAACCCTTCACTCACTGTAAAAATGTTTTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073673   None 265 None 7
ENSDART00000073675 Essential Splice Site 270 271 None 10
ENSDART00000121545 Essential Splice Site 270 271 None 10
ENSDART00000126714 Missense 246 314 9 11
Genomic Location (Zv9):
Chromosome 7 (position 60887235)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60106200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTCAGGCAAAAGCAGCACTGATGCCCCTGAAGAAGAAAGCAGACAG[T/A]AAGTCAATTATTAAATGGGAATATTTATTTATGTTCATCATTCAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073673   None 265 None 7
ENSDART00000073675   None 271 None 10
ENSDART00000121545   None 271 None 10
ENSDART00000126714 Nonsense 262 314 10 11
Genomic Location (Zv9):
Chromosome 7 (position 60890988)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60109953
KASP Assay ID:
554-5120.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATGAAGTTGCTTTTAAACAAGCAGATGTCTGTGCAATGTGAATTTT[G/A]GGGTCTTTTCTATAATGGAGAGAGACTCTCTAAAGACAGAACTGTTGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link