ythdc1

Ensembl ID:
ENSDARG00000051953
ZFIN ID:
ZDB-GENE-041114-114
Description:
YTH domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001007411]
Human Orthologue:
YTHDC1
Human Description:
YTH domain containing 1 [Source:HGNC Symbol;Acc:30626]
Mouse Orthologue:
Ythdc1
Mouse Description:
YTH domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443713]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25322 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13549 Nonsense Available for shipment Available now
sa14642 Essential Splice Site Available for shipment Available now
sa20594 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073671 Essential Splice Site 9 679 1 16

The following transcripts of ENSDARG00000051953 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 72908732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATCCACGCGGGGCTCAAGATGTCCGTCGACAGGAGAGACGAGAAAG[G/T]TAAACGATCACATTTGTGTCCACAGATTCACTAACAAAGGATTTTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073671 Nonsense 98 679 3 16

The following transcripts of ENSDARG00000051953 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 72910584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAAAAAGACCAGCAATCCCAGAGGAAGACACGCACCAGAAGAKCTATA[T/A]GATGACAGAAAGAACCATTCTGGAAGAGGAGGTGCGTCTCGGGCTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073671 Essential Splice Site 606 679 None 16

The following transcripts of ENSDARG00000051953 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 72930848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCGCTTCAGGGAAAAGAGGGTYGTCCGCTCTTTCGCCTCCAGTTTGG[T/C]AATGATTTGCCTCTTAAARCACACTCAGATACTGCCTGCAAGGCATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073671 Nonsense 650 679 16 16

The following transcripts of ENSDARG00000051953 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 72932753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGACCGTCAGAGAGAGCGTGACCGACCCAGAGACGGACGGAGAGAC[C/T]GAGAGCGAGAACGTGGACGGGAGCGGGACCGCGAGAGAGAGAGAATTCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0eaqgg19