pc

Ensembl ID:
ENSDARG00000051939
ZFIN ID:
ZDB-GENE-000831-1
Description:
pyruvate carboxylase, mitochondrial [Source:RefSeq peptide;Acc:NP_571625]
Human Orthologue:
PC
Human Description:
pyruvate carboxylase [Source:HGNC Symbol;Acc:8636]
Mouse Orthologue:
Pcx
Mouse Description:
pyruvate carboxylase Gene [Source:MGI Symbol;Acc:MGI:97520]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21111 Nonsense Available for shipment Available now
sa34211 Nonsense Mutation detected in F1 DNA During 2017
sa12351 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073654 Nonsense 682 1181 15 21
ENSDART00000136999   None 472 None 10
Genomic Location (Zv9):
Chromosome 7 (position 61005227)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60224192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGTTGCCAAAGAGAACGGAATGGATATATTTCGTGTTTTTGACTCCT[T/A]GAATTATATTCCCAACATGCTTTTGGGGATGGAGGCTGCAGGGGCAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073654 Nonsense 725 1181 15 21
ENSDART00000136999   None 472 None 10
Genomic Location (Zv9):
Chromosome 7 (position 61005097)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60224062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAGATGTGTCTGACCCCATGAGACAGAAATATTCACTGGACTACTA[T/A]CTGAAGCTGGCCGATGAGCTAGTTAAAGCTGGAACACACATACTATCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073654 Nonsense 925 1181 18 21
ENSDART00000136999   None 472 None 10
Genomic Location (Zv9):
Chromosome 7 (position 60975697)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60194662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGACCCCCTCCTCTAAGATTGTGGGCGATCTGGCTCAGTTTATGGTG[C/T]AAAACTCTCTCTCTCKTGCTGAAGTGGAAAAGAGAGCAGACGAGCTCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link